Out of the gate

A: Obviously you're not here to convince me to stay...
V: ...
A: Nice. Wow, that's just great.
V: You can't expect things to be the way they were for us in the city. It's a different world here.
A: No! It's not that different. You have the same choices; you're just choosing differently.
V: No I'm not. I just need time to figure it out. Why can't you see that?
A: Because it sucks seeing it from the outside, Vivienne. And that's what I am now, an outsider.
V: No, you're not. You'll never be.
A: Just admit things have changed. You have changed.

Son de Mozart

Ladies and gentleman
The Klazz Brothers and the Cuba Percussion
We have a little song here for you that you might enjoy
This is a piece of music very well known 250 years ago
Everybody used to dance to it
Make love to it
Enjoy themselves to it
Follow trust and lust
Here we go

And now that we are here
We would like to play it to you
Son de Mozart

It will make you happy
It will make you dance

It will give you a minute to absolute wellness

Programando yo?

Pues si, programando estoy! Es un programita extremadamente fácil, pero suficientemente chulo como para que me pueda servir. Es genial, hasta cuenta por mi si se lo pido! Estoy muy orgullosa, me ha salido todo casi sola, sin tener que mirar nada. Es pura intuición! Eso, y mi imaginación!

Conversation between Data and Commander Cris.

D:Hello ma'am.
C:Data, help me out, will you?
D:Checking data bases and waiting for instructions, ma'am...
C:These are the initial sequences:

C: Sequence 1 is ACGGGAGGACGGGAAAATTACTACGGCATTAGC
C: Sequence 2 is ATAGTGCCGTGAGAGTGATGTAGTA

C:Data,concatenate them, being sequence 2 next to the promoter.
D: Concatenation done.

ATAGTGCCGTGAGAGTGATGTAGTAACGGGAGGACGGGAAAATTACTACGGCATTAGC

C:Translate it to RNA.

D:RNA sequence displayed, ma'am.

AUAGUGCCGUGAGAGUGAUGUAGUAACGGGAGGACGGGAAAAUUACUACGGCAUUAGC

C:Data, show me the reverse complement of the DNA fragment.
D:Done.

GCTAATGCCGTAGTAATTTTCCCGTCCTCCCGTTACTACATCACTCTCACGGCACTAT

C:Show me the actual DNA sequence.

ATAGTGCCGTGAGAGTGATGTAGTAACGGGAGGACGGGAAAATTACTACGGCATTAGC
TATCACGGCACTCTCACTACATCATTGCCCTCCTGCCCTTTTAATGATGCCGTAATCG

C:Data, how long would the peptide chain be?
D:The resulting peptide would have a length of 19.3333333333333 aa,
Ma'am.
C:Ok. Data, find all dithymidine sequences and highlight them.

ATAGTGCCGTGAGAGTGATGTAGTAACGGGAGGACGGGAAAA[TT]ACTACGGCA[TT]AGC

D: 2 thymidine pairs found.

C:Nice job, thanks Data. Oh, and by the way, you should meet
Jane. At least she will get your jokes... Not to offend, but
even the brightest cookie at the vulcan Ministry of Science
wouldn't get 'em! Although... have you ever seen a Vulcan laugh?
D: Actually yes ma'am, stardate 991876...ma'am? Where are you
going? Ma'am?

by me! Espero que salga en el examen! Me lo voy a pasar bomba, jajaja.

Postulados de Perlman

Me encantan estos postulados. Es la versión "El balón es mi mejor amigo" de Oliver y Benji, pero a lo microbiólogo!

Postulados de David Perlman (1979)

1. El microorganismo es siempre correcto, tu amigo y un compañero sensible
2. No hay microorganismo estúpido
3. Los microorganismos pueden o podrán hacerlo todo
4. Los microorganismos son más ingeniosos que los químicos, sabios, ingenieros, dinàmicos y otros
5. Si cuidas a tus amigos microorganismos, ellos cuidarán de tu futuro ( y tu vivirás más feliz que antes)

It's SP time!

3 días, playa, libro, Toya, PS 1, PSP, Advanced SP

--> Final Fantasy VII: Crisis Core
--> Super Mario World 2, Harvest Moon, Mario's Picross, Warioland 4, Zelda: Four Swords, Harry
Potter, Kirby Star Red Diamond, Super Mario Land, Pokemon Rojo/Azul/Amarillo/Oro.

Voy a disfrutar como una cría! ^^

Super Mario Land - Low-tech Son

*-* son geniales estos tios! y que recuerdos! a que saco la game boy... XD

I just need to get it out of my system or my head is going to explode

No me lo puedo creer. El libro "The Prokaryotes: v. 4 Bacteria: Firmicutes, Cyanobacteria (book + online access) vale 741,52€!